Archives

  • 2022-09
  • 2022-08
  • 2022-07
  • 2022-06
  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2020-03
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • br In the present study

    2022-04-29


    In the present study, the mRNA and protein levels of GPR110 were examined in 117 paired GC specimens and adjacent non-tumorous tis-sues. The association between GPR110 AUY922 and the clin-icopathological parameters as well as the 5 year overall and recurrence-free survival of GC patients was analyzed. The results indicate that GPR110 may be a predictive biomarker for the poor prognosis in pa-tients with GC.
    Table 1
    Relationship between GPR110 expression in tumorous tissues and clin-icopathological characteristics in patients with gastric cancer.
    Clinicopathological N GPR110
    Pearson χ2 P-value
    characteristic
    Note: Bold values have statistical significance.
    2. Material and methods
    2.1. Patients and samples
    We obtained 117 paired GC tissues and adjacent non-tumorous tissues from patients who underwent a radical resection from the same surgical team and were histologically and clinically diagnosed with GC. None of the patients had received preoperative treatments, for example chemotherapy, radiotherapy or other related anti-tumor treatments. Surgeries were performed at the Department of Gastrointestinal Surgery, the Affiliated Wenling Hospital of Wenzhou Medical University between June 2010 and November 2012. The clin-icopathological parameters, including age, gender, tumor differentia-tion, tumor size, lymph node metastasis, tumor stage and TNM stage were retrospectively collected. All tissue samples were immediately collected and cryopreserved in liquid nitrogen for further study. A portion of each specimen was fixed with 10% paraformaldehyde and embedded in paraffin blocks. Written informed consent was obtained from the patients prior to participation in this clinical trial and re-search, and the research protocols were approved by the ethics com-mittee of the Affiliated Wenling Hospital of Wenzhou Medical University. The clinicopathological characteristics of the patients are presented in Table 1.
    2.2. RNA isolation and quantitative real-time PCR (qRT-PCR)
    Total RNA was extracted from tissue sample using TRIzol reagent (Invitrogen, Grand Island, NY, USA) as described by the manufacturer and RNAs (500 ng) were reverse transcribed using the PrimeScript RT Master Mix (Takara, Dalian, China). Quantitative real-time PCR was performed to detect the expression levels of GPR110 using the SYBR Premix Ex Taq (Takara, Dalian, China) on the ABI Prism 7900 H T (Applied Biosystems, Foster City, CA, USA). The relative expression levels of GPR110 were normalized to GAPDH. The reactions were in-cubated in a 384-well optical plate at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s and 60 °C for 30 s. The primer sequences were as  Pathology - Research and Practice 215 (2019) 539–545
    follows: GPR110 Forward: GCCCAGTCGAAGAATATCAGC, Reverse:
    GCCCATGTGACCATAATAATGGA; GAPDH Forward: CGCTGAGTACGT
    CGTGGAGTC Reverse: GCTGATGATCTTGAGGCTGTTGTC. The 2−ΔΔCt method was used to quantify the relative CHOP expression levels.
    2.3. Immunohistochemistry
    Tissue sections (4 lm thick) were deparaffinized with xylene, rehy-drated, and subjected to microwave antigen retrieval in citrate buffer (pH 6.0) for 20 min. Endogenous peroxidase was quenched with 3% hydrogen peroxide for 10 min. The sections were then separately in-cubated with rabbit anti-human antibody against GPR110 (Atlas Antibodies, Stockholm, Sweden) at 4 C overnight. After washing, sec-tions were incubated with horseradish peroxidase conjugated sec-ondary antibody (Santa Cruz Biotechnology) for 20 min. Sections were counterstained with hematoxylin, dehydrated, and mounted. Negative controls were included by omitting the primary antibody. Photographs were taken with the microscope (Nikon, ECLIPSE 50i) and software NIS-Elements v4.0. Using Image-Pro Plus software (v. 5.0), average values of integrated optical density (IOD) was obtained by analyzing five random fields per slide. Every index was detected a minimum of three times. According to the higher 95% confidence interval (CI) of the IOD value of IHC staining of GPR110 expression in adjacent samples, we divided the GC patients into two groups: GPR110 high group and GPR110 low group.
    2.4. Statistical analysis
    All statistical analyses were performed using SPSS 19.0 (SPSS Inc, Chicago, IL, USA) software and presented with the GraphPad prism software (GraphPad Software, San Diego, CA, USA). Results of quanti-tative real-time PCR were expressed as mean ± S.E.M. The Student’s t test and the Chi-square (χ2) test were used to evaluate statistical dif-ferences of GPR110 expression in different samples and examine the relationship between GPR110 expression and clinicopathological fea-tures. Patient survival and their differences were determined using the Kaplan-Meier method and the log-rank test. Univariate and multivariate prognosis analyses were performed using the Cox proportional hazards regression model. P < 0.05 indicated that the differences were statis-tically significant.