Archives
-
br Please cite this article as Mei D et al
2020-03-24
Please cite this article as: Mei D et al., Actively priming autophagic cell death with novel transferrin receptor-targeted nanomedicine for synergistic chemotherapy against breast cancer, Acta Pharmaceutica Sinica B, https://doi.org/10.1016/j.apsb.2019.03.006 + MODEL Priming autophagic cell
-
br for preventing endometrial cancer and improve progestin b
2020-03-24
for preventing endometrial cancer and improve progestin-based con-servative treatment in early stage endometrial cancer. Authors’ contributions The conception and design of the study: Xiaojun Chen and Congjian The acquisition of data: Qiaoying Lv, Liying Xie, Yali Cheng, Weiwei Shan, Chen
-
br AGGTTGACGAACCGCTCATTC br CONTACT FOR REAGENT
2020-03-17
AGGTTGACGAACCGCTCATTC CONTACT FOR REAGENT AND RESOURCE SHARING Further information and requests for resources and reagents should be directed to and will fulfilled by the Lead Contact, Feixiong Cheng ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines Human breast ca
-
br Conclusion br In summary this study demonstrates that
2019-11-11
Conclusion In summary, this Dorsomorphin study demonstrates that patients with thy-roid cancer have a clear need for a strong patient-surgeon relationship, characterized by informational and emotional support as well as respect for the individual. When these needs were met, patients experienced
-
br zdelikara A Tan M
2019-11-11
16. Özdelikara A, Tan M. The effect of reflexology on the quality of life with breast cancer patients. Complement Ther Clin Pract 2017; 29:122-9. 17. Flynn LL, Bush TR, Sikorskii A, Mukherjee R, Wyatt G. Understanding the role of stimulation in reflexology: development and testing of a robotic
-
br The outline of the paper
2019-11-11
The outline of the paper is as follows. In Section 2, we give a brief overview of the modeling of the cancer L-NAME hydrochloride invasion into the extracellular matrix. In Section 3, we describe the adaptive moving mesh finite difference method. Section 4 provides the numerical details of the ad
-
br Recent reports propose that the natural
2019-10-24
Recent reports propose that the natural polysaccharide-based ma-terials advance the innovative approaches in drug delivery, therapeutic strategies and tissue engineering. The sulfated polysaccharides such as fucoidan, carrageenan, alginate, and chitosan have preferable phar-macological properties
-
br Isothermal titration calorimetry ITC A nity constants and
2019-10-16
Isothermal titration calorimetry (ITC). Affinity constants and binding stoichiometry between native/conjugate proteins and mAbs were determined by isothermal titration calorimetry using a VP-ITC MicroCalorimeter (GE Healthcare, Uppsala, Sweden) provided with a ThermoVac accessory for thermostatting
-
Trichostatin A (TSA) br Patients screened br Patients enroll
2019-10-15
Patients screened Patients enrolled Patients received at least 1 dose of medication Patients completed study Patients not enrolled (n=50) Patients withdrawn (n=12) Patient whished to leave the study (n=3) Investigator’s decision (n=3) Major protocol violation (n=2) Pa
-
br average diameter of nm Fe
2019-10-14
average diameter of 10 nm. [email protected] nanoparticles were fabricated by reverse-phase microemulsion method. It is clearly that the core-shell structure nanoparticles consist of SiO2 layer with thickness of about 10 nm, as shown in Fig. 1c. Finally, the amino-modified [email protected] nanoparticles rea
-
br Based on the experimental methods and experience
2019-10-14
Based on the experimental methods and experience of the two trials described above, we simply collected the local recur-rence data of patients with resected pancreatic head cancer and pancreatic body cancer in this study. Both in establishing the three-dimensional local recurrence map model on tem
-
br Rank correlation of multi criteria ranking algorithm
2019-10-11
Rank correlation of multi-criteria ranking algorithm and overall expert opinion for patient 1. MCRA (Patient 1) Overall Expert Opinion Overall Expert Opinion Correlation Coe cient 1.000∗∗ 1.000 Overall Expert Opinion Correlation Coe cient 1.000∗∗ 1.000 Rank correlation of multi-
-
br Model evaluation criteria br In
2019-10-09
2.2. Model evaluation criteria In medical diagnosis, an outcome of a test is called negative if a person is not detected with the disease (esophageal cancer here). In the data-set, a person diagnosed with esophageal cancer is described as ‘abnormal’, ‘normal’ otherwise. Hence, we use ‘abnormal’
-
br Pathway analysis of the ESA miRNAs and their performance
2019-10-08
3.2. Pathway analysis of the ESA miRNAs and their performance on classification The top-ranked miRNAs and mRNAs by the estimated essential score alterations (ESA) were kept for the following analysis. Differential Jasplakinolide analysis was carried out by using the edgeR package [23] in R for
-
br Giorgio Corti et al br version Instead
2019-10-07
Giorgio Corti et al version). Instead, the FUSION panel has been designed selecting the most frequent oncogenic kinases involved in fusions and the most frequently rearranged partners, identified on the basis of the available literature and The Cancer Genome Atlas database. Custom probes wer
176 records 10/12 page Previous Next First page Previous 5 pages 678910 Next 5 pages Last page